Sequence ID | >WENV170016002 |
Genome ID | AZIJ01007277 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 142 |
End posion on genome | 66 |
Amino Acid | Pro |
Anticodon | CGG |
Upstream region at tRNA start position |
ttttggtcat |
tRNA gene sequence |
CGGAGTGTAGCGCAGCCAGGTAGCGCGTCTCGTTCGGGACGAGAAGGCCGCAGGTTCGAA |
Downstream region at tRNA end position |
aatccttatc |
Secondary structure (Cloverleaf model) | >WENV170016002 Pro CGG t ACCA aatccttatc C - G G - C G - C A - T G - C T T G - C T A T T G T C C A C G A A + | | | | G C C G C G G C A G G C A | | | | T T G G C G C G T A G AGGCC T - A C - G T - A C - G G - C T A T G C G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |