Sequence ID | >WENV170016006 |
Genome ID | AZIJ01007460 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 1679 |
End posion on genome | 1603 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
cgggcagtga |
tRNA gene sequence |
GCGGTTGTAGCTCAGATGGTTAGAGTGCCGGCCTGTCACGCCGGAGGTCGCGGGTTCGAG |
Downstream region at tRNA end position |
ccgctgccac |
Secondary structure (Cloverleaf model) | >WENV170016006 Asp GTC a GCCA ccgctgccac G - C C - G G - C G - C T - A T - A G - C C G T T G C C C A A G A A + | | | | G T C T C G G C G G G C G | | | + T T G G A G T T T A G AGGTC C - G C - G G - C G - C C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |