Sequence ID | >WENV170016012 |
Genome ID | AZIJ01007816 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 217 |
End posion on genome | 292 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
taaatattct |
tRNA gene sequence |
GCGAAAATAGCTCAGTTGGTAGAGCGCCACCTTGCCAAGGTGGAGGTCGCGGGTTCGAAT |
Downstream region at tRNA end position |
ccttgaatgc |
Secondary structure (Cloverleaf model) | >WENV170016012 Gly GCC t TCAA ccttgaatgc G - C C - G G - C A - T A - T A - T A - T T A T T G C C C A T G A A + | | | | G T C T C G G C G G G C G | | | | T T G G A G C T A G AGGTC C - G C - G A - T C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |