Sequence ID | >WENV170016013 |
Genome ID | AZIJ01007816 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 351 |
End posion on genome | 435 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
taaaacaact |
tRNA gene sequence |
GCTCGAGTGGTGGAATTGGTAGACACGCCGGACTTAAAATCCTGTGACCATTTGGTCGTG |
Downstream region at tRNA end position |
aaaagcttct |
Secondary structure (Cloverleaf model) | >WENV170016013 Leu TAA t ACtt aaaagcttct G + T C - G T - A C - G G - C A - T G - C T G T C G C C C A T A A G | | | | | A T G G T G G C G G G C G | | | T T G A C A C T A G G TGACCATTTGGTCGT C - G C T G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |