Sequence ID | >WENV170016015 |
Genome ID | AZIJ01008062 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 427 |
End posion on genome | 344 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
gaccttttta |
tRNA gene sequence |
GGGAGGGTTCCCGAGTGGCCAAAGGGATCAGACTGTAAATCTGACGCGCAAGCTTCGGTG |
Downstream region at tRNA end position |
tgtaaataca |
Secondary structure (Cloverleaf model) | >WENV170016015 Tyr GTA a ACCA tgtaaataca G - C G - C G + T A C G - C G - C G - C T A T C C A C C A T G A T | | | | | G G G C C C G G T G G C G | | | T T C A G G G C A A A CGCGCAAGCTTC T - A C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |