Sequence ID | >WENV170016017 |
Genome ID | AZIJ01008062 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 188 |
End posion on genome | 114 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
ggcttttgag |
tRNA gene sequence |
GCTCATATAGCTCAGCGGTAGAGCACTTCCTTGGTAAGGAAGAGGTCACCGGTTCAAGTC |
Downstream region at tRNA end position |
cattgattga |
Secondary structure (Cloverleaf model) | >WENV170016017 Thr GGT g TCCA cattgattga G - C C - G T - A C - G A - T T - A A - T T G T T G G C C A G A A | | | | | A C C T C G A C C G G C G | | | | T T G G A G C T A A AGGTC C - G T - A T - A C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |