Sequence ID | >WENV170016018 |
Genome ID | AZIJ01008240 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 12682 |
End posion on genome | 12596 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
cacgacacct |
tRNA gene sequence |
GCCCAGGTGGCGGAATTGGTAGACGCGCTAGCTTCAGGTGCTAGTGTCCGTATGGACGTG |
Downstream region at tRNA end position |
ttttccacta |
Secondary structure (Cloverleaf model) | >WENV170016018 Leu CAG t ACCA ttttccacta G - C C - G C - G C - G A - T G - C G - C T G T T C T C C A T A A G + | | | | G T G G C G G G A G G C G | | | T T G A C G C T A G G TGTCCGTATGGACGT C - G T - A A - T G - C C - G T T T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |