Sequence ID | >WENV170016020 |
Genome ID | AZIJ01008248 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 18333 |
End posion on genome | 18257 |
Amino Acid | Pro |
Anticodon | CGG |
Upstream region at tRNA start position |
aattggcgag |
tRNA gene sequence |
CGGAGTGTGGCGCAGTCTGGTAGCGCACCTCGTTCGGGACGAGGGGGTCGCAGGTTCGAA |
Downstream region at tRNA end position |
ctaaaagacg |
Secondary structure (Cloverleaf model) | >WENV170016020 Pro CGG g ACCA ctaaaagacg C - G G - C G - C A - T G - C T - A G - C T A T C G T C C A T G A G | | | | | G C C G C G G C A G G C T | | | | T T G G C G C G T A A GGGTC C - G C - G T - A C - G G - C T A T G C G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |