Sequence ID | >WENV170016036 |
Genome ID | AZIJ01009456 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 418 |
End posion on genome | 494 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
actatagtag |
tRNA gene sequence |
AGTCTCATAGCTCAGCTGGTTAGAGCGCTACACTGATAATGTAGAGGTCGGCAGTTCGAG |
Downstream region at tRNA end position |
aataggatta |
Secondary structure (Cloverleaf model) | >WENV170016036 Ile GAT g ACTA aataggatta A - T G - C T - A C - G T - A C - G A - T T G T C C G T C A C G A A | | | | | G T C T C G G G C A G C G | | | | T T G G A G C T T A G AGGTC C - G T - A A - T C - G A - T C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |