| Sequence ID | >WENV170016040 |
| Genome ID | AZIJ01009542 |
| Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
| Species | |
| Start position on genome | 1171 |
| End posion on genome | 1082 |
| Amino Acid | Ser |
| Anticodon | GCT |
| Upstream region at tRNA start position |
acgggtcggc |
| tRNA gene sequence |
GGAGACGTGGCCGAGTGGTCGAAGGCGCTCCCCTGCTAAGGGAGTAGGCGGGAAACCGTC |
| Downstream region at tRNA end position |
caatcctctt |
| Secondary structure (Cloverleaf model) | >WENV170016040 Ser GCT
c GCCA caatcctctt
G - C
G - C
A - T
G - C
A - T
C - G
G - C T A
T T T C C C A
T G A G + | | | | G
G G C C G G A G G G C
G | | | T T
T A G G C
C G A G TAGGCGGGAAACCGTCTC
C - G
T - A
C - G
C - G
C - G
C A
T A
G C T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |