Sequence ID | >WENV170016048 |
Genome ID | AZIJ01009984 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 1325 |
End posion on genome | 1240 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
ctaaataaaa |
tRNA gene sequence |
GCGCACGTGGCGGAATTGGTAGACGCGCTAGCTTGAGGGGCTAGTATTCGCTTAGAATGT |
Downstream region at tRNA end position |
ttagtctttc |
Secondary structure (Cloverleaf model) | >WENV170016048 Leu GAG a ACtt ttagtctttc G - C C - G G - C C - G A - T C - G G - C T A T T C T T C A T A A G + | | | | G T G G C G G G A A G C G | | | T T G A C G C T A G G TATTCGCTTAGAATGT C - G T - A A - T G - C C - G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |