Sequence ID | >WENV170016061 |
Genome ID | AZIJ01011012 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 555 |
End posion on genome | 466 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
gcgcggcatt |
tRNA gene sequence |
GGAGAGATGCCGGAGTGGTCGAACGGGACGGATTCGAAATCCGTTGTACTGGCAACAGTA |
Downstream region at tRNA end position |
tacaaataaa |
Secondary structure (Cloverleaf model) | >WENV170016061 Ser CGA t GCCA tacaaataaa G - C G - C A - T G - C A - T G - C A - T T A T A T C C C A T G A G | | | | | A G G G C C T A G G G C G | | | T T T A C G G C G A G TGTACTGGCAACAGTACC A - T C - G G - C G - C A - T T A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |