Sequence ID | >WENV170016064 |
Genome ID | AZIJ01011212 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 405 |
End posion on genome | 481 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
tttgttgtat |
tRNA gene sequence |
AGGGGCGTAGTTCCAATTGGTAGAACGGCGGTCTCCAAAACCGACGGTTGGGGGTTCGAG |
Downstream region at tRNA end position |
cttacctcgc |
Secondary structure (Cloverleaf model) | >WENV170016064 Trp CCA t GCCA cttacctcgc A - T G - C G - C G - C G - C C - G G - C T G T C T C C C A A A C A | + | | | G T C T T G G G G G G C T | | | | T T G G A A C G T A G CGGTT G A C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |