| Sequence ID | >WENV170016069 |
| Genome ID | AZIJ01011611 |
| Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
| Species | |
| Start position on genome | 10662 |
| End posion on genome | 10589 |
| Amino Acid | Cys |
| Anticodon | GCA |
| Upstream region at tRNA start position |
gacttttccc |
| tRNA gene sequence |
GGCGCGGTGGCAGAGTGGTTATGCAGCGGACTGCAACTCCGTGTACGCCGGTTCGATTCC |
| Downstream region at tRNA end position |
atttttcttc |
| Secondary structure (Cloverleaf model) | >WENV170016069 Cys GCA
c TCCA atttttcttc
G - C
G - C
C - G
G - C
C - G
G - C
G - C T T
T C G G C C A
G A G | | | | | G
T G A C G G C C G G C
G | | | T T
G A T G C
T T A GTAC
G + T
C - G
G - C
G - C
A - T
C C
T A
G C A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |