Sequence ID | >WENV170016075 |
Genome ID | AZIJ01011748 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 206 |
End posion on genome | 131 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
ggcattttgt |
tRNA gene sequence |
GGGGCCTTAGCTCAGCTGGGAGAGCGCCTGATTTGCATTCAGGAGGTCATCGGTTCGATC |
Downstream region at tRNA end position |
tcaccttcgg |
Secondary structure (Cloverleaf model) | >WENV170016075 Ala TGC t ACCA tcaccttcgg G - C G - C G + T G - C C - G C - G T - A C T T T A G C C A C G A A | | | | | G T C T C G A T C G G C G | | | | T T G G A G C G A G AGGTC C - G C - G T - A G - C A - T T T T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |