Sequence ID | >WENV170016077 |
Genome ID | AZIJ01012082 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 4055 |
End posion on genome | 3981 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
nnnnnnnnnn |
tRNA gene sequence |
GGCCTCATAGTTCAATGGATAGAATAGAAGTTTCCTAAACTTTAGATCCAAGTTCGATTC |
Downstream region at tRNA end position |
cattatttgt |
Secondary structure (Cloverleaf model) | >WENV170016077 Arg CCT n ACAA cattatttgt G + T G - C C - G C - G T - A C - G A - T T T T G G T T C A T A A A | | | | | G G C T T G C C A A G C G | | | + T T A G A A T T A A AGAT G + T A - T A - T G - C T - A T A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |