Sequence ID | >WENV170016078 |
Genome ID | AZIJ01012095 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 2039 |
End posion on genome | 1964 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
tacctgtaat |
tRNA gene sequence |
GGCCCCTTAGCTCAGTGGTTAGAGCAGCCGACTCATAATCGGTTGGTCCCCAGTTCAAAT |
Downstream region at tRNA end position |
tttatcatcc |
Secondary structure (Cloverleaf model) | >WENV170016078 Met CAT t ACCA tttatcatcc G - C G - C C - G C - G C - G C - G T - A T A T G G G T C A T G A A | | | | | A G C T C G C C C A G C G | | | | T T T G A G C T A A TGGTC G + T C - G C - G G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |