Sequence ID | >WENV170016079 |
Genome ID | AZIJ01012112 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 132 |
End posion on genome | 206 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
aaccaaaaac |
tRNA gene sequence |
GCCGGTGTAGCTCAGGGGTAGAGCGTTTCCTTGGTAAGGAAGAGGTCATGGGTTCAATTC |
Downstream region at tRNA end position |
gtttagaata |
Secondary structure (Cloverleaf model) | >WENV170016079 Thr GGT c TCAA gtttagaata G - C C - G C - G G + T G + T T - A G - C T T T T A C C C A G A A | | | | | A G C T C G A T G G G C G | | | | T T G G A G C T A G AGGTC T + G T - A T - A C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |