Sequence ID | >WENV170016082 |
Genome ID | AZIJ01012125 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 809 |
End posion on genome | 886 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
ataaccaatt |
tRNA gene sequence |
CGGGGTGTAGCGTAGCCCGGTTATCGCGCCGCGTTTGGGACGCGGAGGTCGCAGGTTCGA |
Downstream region at tRNA end position |
tttttaagag |
Secondary structure (Cloverleaf model) | >WENV170016082 Pro TGG t ACAA tttttaagag C - G G - C G - C G - C G - C T - A G - C T A T C G T C C A C C G A A | | | | | G C T G C G G C A G G C G | | | T T G T C G C T T A G AGGTC C - G C - G G - C C - G G - C T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |