Sequence ID | >WENV170016086 |
Genome ID | AZIJ01012266 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 422 |
End posion on genome | 495 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
cgacctttga |
tRNA gene sequence |
GGCCGAGTAGCAAAGTGGTTATGCTCCGGATTGCAAATCCGTCTACGCCGGTTCGATTCC |
Downstream region at tRNA end position |
ccattcgaaa |
Secondary structure (Cloverleaf model) | >WENV170016086 Cys GCA a TCCA ccattcgaaa G - C G - C C - G C - G G - C A - T G - C T T T C A G C C A G A A | | | | G T A A C G G C C G G C G | | | T T G A T G C T T T CTAC C T C - G G - C G - C A - T T A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |