Sequence ID | >WENV170016090 |
Genome ID | AZIJ01012401 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 644 |
End posion on genome | 560 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
tttaaaattt |
tRNA gene sequence |
GGAGGGGTTCCCGAGTGGCCAAAGGGATCAGACTGTAAATCTGACGGCTCAGCCTTCGCT |
Downstream region at tRNA end position |
gtttccagtg |
Secondary structure (Cloverleaf model) | >WENV170016090 Tyr GTA t ACCA gtttccagtg G - C G - C A - T G - C G - C G - C G + T T A T C G A C C A T G A T | | | | | G G G C C C G C T G G C G | | | T T C A G G G C A A A CGGCTCAGCCTTC T - A C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |