Sequence ID | >WENV170016092 |
Genome ID | AZIJ01012401 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 415 |
End posion on genome | 340 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
ccgctccagt |
tRNA gene sequence |
GCTGATATAGCTCAGATGGTAGAGCGCACCCTTGGTAAGGGTGAGGTCCCCAGTTCGATT |
Downstream region at tRNA end position |
cttctttact |
Secondary structure (Cloverleaf model) | >WENV170016092 Thr GGT t ACCA cttctttact G - C C - G T - A G - C A - T T - A A - T T T T G G G T C A A G A A | | | | | G T C T C G C C C A G C G | | | | T T G G A G C T A G AGGTC C - G A - T C - G C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |