Sequence ID | >WENV170016093 |
Genome ID | AZIJ01012402 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 400 |
End posion on genome | 310 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
ccgcgtgttc |
tRNA gene sequence |
GGAGAGGTGGCCGAGAGGCCGAAGGCGCTCCCCTGCTAAGGGAGTATACCTCAAAAGGGT |
Downstream region at tRNA end position |
ttttatgaat |
Secondary structure (Cloverleaf model) | >WENV170016093 Ser GCT c GCCA ttttatgaat G - C G - C A - T G - C A - T G - C G - C T A T C G C C C A A G A G | | | | | G G G C C G G C G G G C G | | | T T C A G G C C G A G TATACCTCAAAAGGGTATC C - G T - A C - G C - G C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |