| Sequence ID | >WENV170016097 |
| Genome ID | AZIJ01012481 |
| Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
| Species | |
| Start position on genome | 782 |
| End posion on genome | 697 |
| Amino Acid | Leu |
| Anticodon | GAG |
| Upstream region at tRNA start position |
tagtagtatt |
| tRNA gene sequence |
GCCGAGGTGGTGGAATTGGTAGACACGCAACCTTGAGGTGGTTGTGCCCATAGGGTGTAG |
| Downstream region at tRNA end position |
attaaagctt |
| Secondary structure (Cloverleaf model) | >WENV170016097 Leu GAG
t ACCA attaaagctt
G + T
C - G
C - G
G - C
A - T
G - C
G + T T G
T T C C C C A
T A A G | | | | | G
T G G T G A G G G G C
G | | | T T
G A C A C
T A G G TGCCCATAGGGTGT
C - G
A - T
A - T
C - G
C - G
T T
T G
G A G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |