Sequence ID | >WENV170016100 |
Genome ID | AZIJ01012498 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 7941 |
End posion on genome | 8014 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
aggctacttg |
tRNA gene sequence |
GCGGGTATAGTTCAATGGTAGAACCTCAGCCTTCCAAGCTGATGGTGCGGGTTCGATTCC |
Downstream region at tRNA end position |
gtctgacgat |
Secondary structure (Cloverleaf model) | >WENV170016100 Gly TCC g TCCA gtctgacgat G - C C - G G - C G - C G - C T - A A - T T T T C G C C C A A A A | | | | | G T C T T G G C G G G C G | | | | T T G G A A C T A C TGGT T - A C - G A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |