Sequence ID | >WENV170016101 |
Genome ID | AZIJ01012498 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 8039 |
End posion on genome | 8114 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
tggtttgtaa |
tRNA gene sequence |
GCTCATGTAGCTCAGTTGGTAGAGCACACCCTTGGTAAGGGTGAGGTCAGCGGTTCAAAT |
Downstream region at tRNA end position |
atatcaaggc |
Secondary structure (Cloverleaf model) | >WENV170016101 Thr GGT a TCCA atatcaaggc G - C C - G T - A C - G A - T T - A G - C T A T T C G C C A T G A A | | | | | A T C T C G A G C G G C G | | | | T T G G A G C T A A AGGTC C - G A - T C - G C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |