Sequence ID | >WENV170016105 |
Genome ID | AZIJ01012708 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 108 |
End posion on genome | 32 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
ccctgccagt |
tRNA gene sequence |
GCCGCCTTAGCTCAGTTGGTTAGAGCGCCTGATTGTGGATCAGGAGGTCCCCCGTTCGAG |
Downstream region at tRNA end position |
ccgctcattt |
Secondary structure (Cloverleaf model) | >WENV170016105 His GTG t ACCA ccgctcattt G + T C - G C - G G + T C - G C - G T - A C G T G G G G C A T G A A | | | | | G T C T C G C C C C G C G | | | | T T G G A G C T T A G AGGTC C - G C - G T - A G - C A - T T A T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |