Sequence ID | >WENV170016113 |
Genome ID | AZIJ01012895 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 25951 |
End posion on genome | 25876 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
tcagtcaatg |
tRNA gene sequence |
GTGGCTGTAGCTCAGTTGGTAGAGCCCAGGATTGTGATTCCTGTGGTCGCGGGTTCAATC |
Downstream region at tRNA end position |
ttttcccccg |
Secondary structure (Cloverleaf model) | >WENV170016113 His GTG g CCCA ttttcccccg G - C T - A G - C G - C C - G T - A G - C C T T T G C C C A T G A A + | | | | A T C T C G G C G G G C G | | | | T T G G A G C T A C TGGTC C - G A - T G - C G - C A - T T T T A G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |