Sequence ID | >WENV170016119 |
Genome ID | AZIJ01013030 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 3195 |
End posion on genome | 3270 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
acgggtcgcc |
tRNA gene sequence |
GCCTCAATAGCTCAGCTGGTAGAGCAACTGTTTCGTAAATAGTAGGTCGGGGGTTCGAGT |
Downstream region at tRNA end position |
tcatcccgcc |
Secondary structure (Cloverleaf model) | >WENV170016119 Thr CGT c ACCA tcatcccgcc G - C C - G C - G T - A C - G A - T A - T T G T C T C C C A C G A A | + | | | G T C T C G G G G G G C G | | | | T T G G A G C T A A AGGTC A - T C - G T - A G + T T - A T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |