Sequence ID | >WENV170016122 |
Genome ID | AZIJ01013088 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 29021 |
End posion on genome | 29097 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
gtcttggtgA |
tRNA gene sequence |
AACAATTTAGCTCAGTTGGTAGAGCAATCGCCTTTTAAGCGATCCGTCCCAGGTTCAACT |
Downstream region at tRNA end position |
aacgcaaagt |
Secondary structure (Cloverleaf model) | >WENV170016122 Lys TTT A TACA aacgcaaagt A - T A A C - G A - T A - T T - A T - A T C T G G T C C A T G A A | | | | | A T C T C G C C A G G C G | | | | T T G G A G C T A A CCGTC A - T T - A C - G G - C C - G C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |