Sequence ID | >WENV170016123 |
Genome ID | AZIJ01013088 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 11160 |
End posion on genome | 11077 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
attgttttgg |
tRNA gene sequence |
GGAAAGGTGGTAGAGAGGCTGAATACGCCGGACTGTAAATCCGGATCGAAAGACACGCTG |
Downstream region at tRNA end position |
aagcaatgat |
Secondary structure (Cloverleaf model) | >WENV170016123 Tyr GTA g ACCA aagcaatgat G - C G - C A - T A - T A - T G - C G - C T A T C G A C C A A G A G | | | | | G G G A T G G C T G G C G | | | T T C A T A C T G A G ATCGAAAGACAC C - G C - G G - C G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |