Sequence ID | >WENV170016124 |
Genome ID | AZIJ01013088 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 10929 |
End posion on genome | 10854 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
tgaagcatgt |
tRNA gene sequence |
GCATCGATAACTCAGTTGGTAGAGTGCCGGTTTGAAAAGCCGATGGTCGCAGGTTCGATT |
Downstream region at tRNA end position |
aaaagcagta |
Secondary structure (Cloverleaf model) | >WENV170016124 Phe GAA t ACCA aaaagcagta G - C C - G A - T T + G C - G G - C A - T T T T C G T C C A T G A A | | | | | G T C T C A G C A G G C G | | | | T T G G A G T T A G TGGTC C A C - G G - C G - C T + G T A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |