Sequence ID | >WENV170016125 |
Genome ID | AZIJ01013088 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 10813 |
End posion on genome | 10730 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
taggttttgg |
tRNA gene sequence |
GGGACGATGGCAGAGTGGTCGAATGCGCCGGACTGTAAATCCGGATCGAAAGACGCCTTG |
Downstream region at tRNA end position |
aagcgtattt |
Secondary structure (Cloverleaf model) | >WENV170016125 Tyr GTA g ACCA aagcgtattt G - C G - C G - C A G C - G G - C A - T T A T G A A C C A T G A G | | | | | G G G A C G C T T G G C G | | | T T T A T G C C G A G ATCGAAAGACGC C - G C - G G - C G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |