Sequence ID | >WENV170016127 |
Genome ID | AZIJ01013088 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 10350 |
End posion on genome | 10276 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
tgcaagacat |
tRNA gene sequence |
GCAGGGGTAGCTCAGCGGTAGAGCGTTCGACTGATAATCGAAAGGTCGGTGGTTCGAAAC |
Downstream region at tRNA end position |
attccgagaa |
Secondary structure (Cloverleaf model) | >WENV170016127 Ile GAT t ACCA attccgagaa G - C C - G A - T G - C G - C G + T G + T A A T C C A C C A G A A | | | | | G C C T C G G G T G G C G | | | | T T G G A G C T A G AGGTC T - A T - A C - G G - C A - T C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |