Sequence ID | >WENV170016128 |
Genome ID | AZIJ01013088 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 10239 |
End posion on genome | 10164 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
cacgttttac |
tRNA gene sequence |
GGGTTGTTAGCTCAGTTGGTAGAGCAACCGGCTTTTAACCGGTTGGCCGCAGGTTCGAGC |
Downstream region at tRNA end position |
gattttaggc |
Secondary structure (Cloverleaf model) | >WENV170016128 Lys TTT c ACCA gattttaggc G - C G - C G - C T - A T + G G - C T - A C G T C G T C C A T G A A | | | | | G T C T C G G C A G G C G | | | | T T G G A G C T A A TGGCC A - T C - G C - G G - C G - C C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |