Sequence ID | >WENV170016130 |
Genome ID | AZIJ01013088 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 10045 |
End posion on genome | 9972 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
agaggtttta |
tRNA gene sequence |
GCGGTATTGGTGTAGTGGTAACACCTCTGCCTTCCAAGCAGATTTCGGGGGTTCGAATCC |
Downstream region at tRNA end position |
atttgatgta |
Secondary structure (Cloverleaf model) | >WENV170016130 Gly TCC a TCCA atttgatgta G - C C - G G - C G - C T - A A - T T - A T A T C C C C C A G A G | | | | | G T T G T G G G G G G C G | | | | T T G A C A C T A C TTTC T - A C - G T - A G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |