Sequence ID | >WENV170016133 |
Genome ID | AZIJ01013088 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 9741 |
End posion on genome | 9666 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
taggttcaat |
tRNA gene sequence |
TCCAGGATAGCTCAGTTGGCAGAGCAAACGGCTGTTAACCGTAAGGTCGCTGGTTCGAGT |
Downstream region at tRNA end position |
gattaaaagg |
Secondary structure (Cloverleaf model) | >WENV170016133 Asn GTT t GCCA gattaaaagg T - A C - G C - G A - T G - C G - C A - T T G T C G A C C A T G A A | | | | | G T C T C G G C T G G C G | | | | T T G G A G C C A A AGGTC A A A - T C - G G - C G - C C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |