Sequence ID | >WENV170016134 |
Genome ID | AZIJ01013088 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 9619 |
End posion on genome | 9544 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
gatacgtttt |
tRNA gene sequence |
GGGGCCTTAGCTCAGTTGGTAGAGCAGGTGCTTTGCAAGCATCAGGTCGAGAGTTCGAAT |
Downstream region at tRNA end position |
ggtttaaaca |
Secondary structure (Cloverleaf model) | >WENV170016134 Ala TGC t ACCA ggtttaaaca G - C G - C G + T G - C C - G C - G T - A T A T C T C T C A T G A A | | | | | G T C T C G G A G A G C G | | | | T T G G A G C T A A AGGTC G - C G + T T - A G - C C - G T A T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |