Sequence ID | >WENV170016136 |
Genome ID | AZIJ01013088 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 7894 |
End posion on genome | 7818 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
caccaacaat |
tRNA gene sequence |
GCAAATGTAGCTCAGTTGGTCAGAGTGCTCGGCTCATAACCGAGGGGTCGCAGGTTCGAA |
Downstream region at tRNA end position |
attcagaaga |
Secondary structure (Cloverleaf model) | >WENV170016136 Met CAT t ACCA attcagaaga G - C C - G A - T A - T A - T T - A G - C G A T C G T C C A T G A A | | | | | G T C T C G G C A G G C G | | | + T T G G A G T T C A G GGGTC C - G T - A C - G G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |