Sequence ID | >WENV170016137 |
Genome ID | AZIJ01013088 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 7676 |
End posion on genome | 7601 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
taacggtttt |
tRNA gene sequence |
GCGGGCGTAGCTCAGTTGGTAGAGCGTCACCTTGCCAAGGTGAGGGTCGTGGGTTCGAAT |
Downstream region at tRNA end position |
ggtttgttgg |
Secondary structure (Cloverleaf model) | >WENV170016137 Gly GCC t TCCA ggtttgttgg G - C C - G G - C G - C G + T C - G G - C T A T C A C C C A T G A A | | | | | G T C T C G G T G G G C G | | | | T T G G A G C T A G GGGTC T - A C - G A - T C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |