Sequence ID | >WENV170016139 |
Genome ID | AZIJ01013088 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 7435 |
End posion on genome | 7360 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
ctgttttttt |
tRNA gene sequence |
AGGGGTTTAGCTCAGCTGGTAGAGCGGCGTCCTTACAAGACGAAGGTCATAGGTTCGATC |
Downstream region at tRNA end position |
tttttagagg |
Secondary structure (Cloverleaf model) | >WENV170016139 Val TAC t ACCA tttttagagg A - T G - C G - C G - C G - C T - A T - A C T T T G T C C A C G A A | + | | | G T C T C G A T A G G C G | | | | T T G G A G C T A G AGGTC G A C - G G - C T - A C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |