| Sequence ID | >WENV170016139 |
| Genome ID | AZIJ01013088 |
| Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
| Species | |
| Start position on genome | 7435 |
| End posion on genome | 7360 |
| Amino Acid | Val |
| Anticodon | TAC |
| Upstream region at tRNA start position |
ctgttttttt |
| tRNA gene sequence |
AGGGGTTTAGCTCAGCTGGTAGAGCGGCGTCCTTACAAGACGAAGGTCATAGGTTCGATC |
| Downstream region at tRNA end position |
tttttagagg |
| Secondary structure (Cloverleaf model) | >WENV170016139 Val TAC
t ACCA tttttagagg
A - T
G - C
G - C
G - C
G - C
T - A
T - A C T
T T G T C C A
C G A A | + | | | G
T C T C G A T A G G C
G | | | | T T
G G A G C
T A G AGGTC
G A
C - G
G - C
T - A
C - G
C A
T A
T A C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |