Sequence ID | >WENV170016141 |
Genome ID | AZIJ01013088 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 7269 |
End posion on genome | 7193 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
ccagtttgtg |
tRNA gene sequence |
GTGGTTGTAGCTCAGTTGGTTAGAGTGCCGGGTTGTGACCCCGGAGGTCGCGGGTTCGAG |
Downstream region at tRNA end position |
aaacacgata |
Secondary structure (Cloverleaf model) | >WENV170016141 His GTG g CCCA aaacacgata G - C T - A G - C G - C T + G T - A G - C T G T T G C T C A T G A A + | | + | G T C T C G G C G G G C G | | | + T T G G A G T T T A G AGGTC C - G C - G G - C G - C G - C T C T A G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |