Sequence ID | >WENV170016142 |
Genome ID | AZIJ01013089 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 6320 |
End posion on genome | 6406 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
atcccatacc |
tRNA gene sequence |
GCCCGGATGGTGAAACTGGTAGACGCAAGGGACTTAAAATTCCTCGGGGGAAACCCCGTG |
Downstream region at tRNA end position |
tgccaaagtg |
Secondary structure (Cloverleaf model) | >WENV170016142 Leu TAA c ACCA tgccaaagtg G - C C - G C - G C - G G - C G - C A - T C T T C G C C C A C A A G | | | | | G T A G T G G C G G G C G | + | T T G A C G C T A G A CGGGGGAAACCCCGT A - T G - C G - C G + T A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |