Sequence ID | >WENV170016143 |
Genome ID | AZIJ01013089 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 6408 |
End posion on genome | 6492 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
cgggcaccat |
tRNA gene sequence |
GCCAAAGTGGTGGAATTGGTAGACACGGCGCATTCAAAATGCGTTGCCGAAAGGCGTGAG |
Downstream region at tRNA end position |
aattttgaag |
Secondary structure (Cloverleaf model) | >WENV170016143 Leu CAA t ACCA aattttgaag G + T C - G C - G A - T A - T A - T G + T T G T C T C C C A T A A G | | | | | G T G G T G G A G G G C G | | | T T G A C A C T A G G TGCCGAAAGGCGT G + T C - G G - C C - G A - T T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |