Sequence ID | >WENV170016144 |
Genome ID | AZIJ01013091 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 5260 |
End posion on genome | 5172 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
taaggtttca |
tRNA gene sequence |
GGATGGTTGCCAGAGCGGTCAAATGGGCTCGCCTGGAAAGCGAGAGTCTCGTAAGAGGCA |
Downstream region at tRNA end position |
gtttcagttt |
Secondary structure (Cloverleaf model) | >WENV170016144 Ser GGA a GCCA gtttcagttt G - C G - C A - T T - A G - C G - C T - A T A T C T T C C A C G A G | | | | | A G G A C C G A A G G C G | | | T T T A T G G C A A G AGTCTCGTAAGAGGCAC C - G T - A C - G G - C C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |