Sequence ID | >WENV170016146 |
Genome ID | AZIJ01013091 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 4893 |
End posion on genome | 4804 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
cacacagttt |
tRNA gene sequence |
GGGCAGGTGGCCGAGAGGCTGAAGGCAACGGTCTTGAAAATCGTCGAGTTAGAAATAGCT |
Downstream region at tRNA end position |
aatacaaaaa |
Secondary structure (Cloverleaf model) | >WENV170016146 Ser TGA t GCCA aatacaaaaa G - C G - C G - C C - G A - T G - C G - C T A T C A C C C A A G A G | | | | | G G G C C G G T G G G C G | | | T T C A G G C T G A A CGAGTTAGAAATAGCTCC A - T C - G G - C G + T T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |