Sequence ID | >WENV170016148 |
Genome ID | AZIJ01013091 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 3845 |
End posion on genome | 3761 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
gcgggttttt |
tRNA gene sequence |
GCGCAAGTGGCGGAATTGGTAGACACGCCATCTTGAGGGGGTGGTGCCGAAAGGCGTGAG |
Downstream region at tRNA end position |
tttctggagg |
Secondary structure (Cloverleaf model) | >WENV170016148 Leu GAG t ACCA tttctggagg G - C C - G G - C C - G A - T A - T G - C T G T C T C C C A T A A G | | | | | G T G G C G G A G G G C G | | T T G A C A C T A G G TGCCGAAAGGCGT C - G C - G A - T T + G C - G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |