Sequence ID | >WENV170016151 |
Genome ID | AZIJ01013091 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 3046 |
End posion on genome | 2962 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
acaagtccac |
tRNA gene sequence |
GCGGAAGTGGCGAAATTGGTAGACGCACCGGTTTTAGGTACCGGCGCCGTAAGGCGTGTG |
Downstream region at tRNA end position |
ttttgatcac |
Secondary structure (Cloverleaf model) | >WENV170016151 Leu TAG c ACCA ttttgatcac G - C C - G G - C G - C A - T A - T G - C T G T C A C C C A T A A G | | | | | G T A G C G G T G G G C G | | | T T G A C G C T A G A CGCCGTAAGGCGT C - G C - G G - C G - C T - A T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |