Sequence ID | >WENV170016155 |
Genome ID | AZIJ01013286 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 1691 |
End posion on genome | 1603 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
taatataact |
tRNA gene sequence |
AGAGAGGTGGCCGAGTGGTCGAAGGCGCACGCCTGGAAAGTGTGTATACCCCAAAAGGGT |
Downstream region at tRNA end position |
ttatttttat |
Secondary structure (Cloverleaf model) | >WENV170016155 Ser GGA t GCtg ttatttttat A - T G - C A - T G - C A - T G - C G - C T A T T T C C C A T G A G + | | | | G G G C C G G A G G G C G | | | T T T A G G C C G A G TATACCCCAAAAGGGTATC C - G A - T C - G G + T C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |