Sequence ID | >WENV170016160 |
Genome ID | AZIJ01013612 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 320 |
End posion on genome | 244 |
Amino Acid | Arg |
Anticodon | TCG |
Upstream region at tRNA start position |
gttaattaat |
tRNA gene sequence |
GGCCTCGTAGTTCAATTGGATAGAATATCAGATTTCGGCTCTGAGGGTTGGAGGTTCGAA |
Downstream region at tRNA end position |
taaataaaac |
Secondary structure (Cloverleaf model) | >WENV170016160 Arg TCG t ACAA taaataaaac G - C G + T C - G C - G T - A C - G G - C T A T T C T C C A T A A A + | | | | G T C T T G G G A G G C G | | | + T T G G A A T A T A A GGGTT T - A C - G A - T G - C A - T T C T G T C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |